Update - Possible Prehistoric Iron Smelting in Ohio
AD
On the questionable assumption that anyone remembers or cares, here is an update on the slowly ongoing investigation of the seemingly prehistoric iron artifacts that appeared 1.5 m (5') below the surface in southern Ohio. The last discussion of this (descending into a bit of lunacy) ended at http://www.archaeologyfieldwork.com/forums/viewtopic.php?t=2728&start=30
We finally have some objective data on Dave Gillilan's anomalous iron artifacts in the form of radiocarbon dating by the AMS laboratory at the University of Arizona. (This lab, a National Science Foundation facility, is known to be one of the best, being one of the three chosen for the 1988 dating of the Shroud of Turin.) This is the iron object that was tested:

Three readings from the carbon content (presumably charcoal fuel used in the smelting process) taken from separate samplings of the object indicate about a 90% probability of origin somewhere between 209 and 783 AD, the two more closely corresponding readings indicating 209 to 551 AD, altogether corresponding more or less to the Middle Woodland Period. These are charts of the readings calibrated against the IntCal04 atmospheric curve using Oxford University's OxCal software:

While this is quite interesting, suggesting that the iron is temporally associated with the Native American artifacts in direct context, one can say with certainty only that these are the numbers returned by the radiocarbon dating process. Carbon dating in the best of circumstances is a tricky business with many pitfalls, and the dating of iron is even more so than that of other materials. For one thing, one can not preclude the possibility of the charcoal content being contaminated by older carboniferous material. It's all just another piece of evidence, for whatever it's worth. And it may well be worth something that the dates are within a just a few hundred years of the apparent age of the temporally diagnostic Native American lithic artifacts. Of course it's a possibility, but it would be quite a coincidence if random contamination of the material were to place it in the same time frame.
Altogether, there remains a lot of time-consuming and expensive research to be done. (And how sad it is that our local archaeological establishment refused to become involved in Dave's initial recovery of the material.)
Photos of the cache find, and background information, are at http://www.daysknob.com/DG.htm
Regards, AD
Post ID#6656 - replied 4/4/2008 10:46 AM
Dmack89
I had never heard of carbon dating Iron artifacts before - can you provdie some references/background on this. Since C14 dating is based on the absorption of C14 by living objects during their lifetime, I am curious as to how it can be seen applicable to ferrous materials.
Thanks
DM
Post ID#6666 - replied 4/4/2008 11:57 AM
prisoner
I had never heard of carbon dating Iron artifacts before - can you provdie some references/background on this. Since C14 dating is based on the absorption of C14 by living objects during their lifetime, I am curious as to how it can be seen applicable to ferrous materials.
Thanks
DM
I have never heard of that either, but a quick google search revealed this article http://www.tms.org/pubs/journals/JOM/0305/Cook-0305.html. Sounds pretty interesting.
Post ID#6674 - replied 4/4/2008 5:38 PM
FireArch
Moderator
So, what happens when the iron is forged with wood that is much older than the time in which the artifact is manufactured (i.e., the old wood problem in other areas of 14C analysis)? Since iron will absorb free carbon it is possible to have old carbon within the iron lattice, giving a false reading, no?
Post ID#6692 - replied 4/6/2008 3:33 PM
AD
Sorry I'm slow - been flu-afflicted for a few days, now far behind in everything.
Thanks for those questions and observations.
Dmack89, the article cited by "prisoner" is a very good introduction, and it was through the authors of this that I quite circuitously found my way to the Univ. of Arizona's AMS lab. For further information, these two URLs give access to excellent papers on the subject (they cost $13.60 each, however):
http://www.ingentaconnect.com/content/arizona/rdc/2002/00000044/00000003/art00012
http://www.ingentaconnect.com/content/arizona/rdc/2001/00000043/00000002/art00016
FireArch, you're right, of course, that (as with radiocarbon dating of a less arcane nature) charcoal from wood that had been dead a long time before its introduction into the artifact material would skew the readings. In this particular case, assuming, as has been suggested, that the iron yielding an apparent age of roughly 1600 years was actually smelted in the nineteenth century AD, the wood for the charcoal would have to have been lying around for a millennium and a half and still be in a condition suitable for the manufacturing process. What are the odds? A more plausible scenario would be fuel consisting of an admixture of charcoal and coal, or possibly iron originally smelted with charcoal and then re-smelted with coal; but even then there is the question of the probability of this randomly yielding an apparent age corresponding to that of the temporally diagnostic lithic artifacts in direct context 1.5 m (5') down in apparently undisturbed terrain. Theoretically it's all possible, of course, and, as I think I made clear, I'm not presenting the data in my previous posting as conclusive proof of anything. It's just something for consideration by those of us that don't assume we fully understand what people here were doing in the distant past. There remains a lot of work to be done, almost certainly not by Ohio's local archaeological "establishment" with its vested interests in established paradigms.
I appreciate your taking an interest, and thanks again for the intelligent and informed observations.
Regards, AD
Post ID#6703 - replied 4/7/2008 5:36 PM
FireArch
Moderator
And where did this smelting take place? Iron is one of the more difficult metals to extract - let alone get hot enough to work - and requires considerable heat and fuel, so the places where this process took place should be rather "obvious" in that it's going to be very intensive and should leave recognizable archaeological "signs."
Once you have a confirmed bloomery then I'll warm up to the idea of blacksmithing in prehistoric North America. Oh, and a couple additional finds such as the one you presented that carbon date to the same period would help. A single date is pretty much useless in archaeology.
Post ID#6704 - replied 4/7/2008 5:42 PM
FireArch
Moderator
Pretty good if the tree used lived a long time and the heartwood was the source for the fire....
Post ID#6710 - replied 4/8/2008 10:07 AM
Dwarmour
I was reading through your article and am confused about some of this. Was this specific iron object found in the ground associated with other artifacts? I couldn't tell if the man who called you had all this stuff cached together in a box in his basement. A couple of questions though (sorry this is long):
-If found in situ, what did the stratigraphy look like? Any burnt earth, or what looks like a kiln of sorts like what Charlie Hatchett had taken pictures of in Texas http://www.archaeologyfieldwork.com/forums/viewtopic.php?t=135? Could you be able to get more samples, say from the very bottom of the feature or outer boundaries?
-about the glass point; was that found with the iron? if so have you ever gotten that tested? I have seen natural glass like some of the stuff you have shown from lightning striking a mineral high in silica, such as sand, and forming it.
I was reading through the article prisoner had posted and it was concluding with, The first warning that an artifact is unsuitable for dating by radiocarbon is when multiple samples are run and the dates obtained are widely variable. You said 90% of the dates came back with the same time period and you ran three, do the associated artifacts date around there?
Post ID#6718 - replied 4/9/2008 6:41 AM
AD
As always, thanks for the observations and questions. First to FireArch:
When I say "apparently undisturbed terrain" I'm referring to a formal report written by a professional and certified geomorphologist with a strong archaeological background. This pertains to an assessment of the stratigraphy of a trench dug to slightly below the depth of the cache find (this was 1.5 m), and adjacent to it. In his report he states "With the exception of the uppermost 20-cm thick plow zone, there is no evidence of prehistoric or historic disturbance of the sediments revealed in the soil profile of the trench." (He identified the soil below the plow zone as being glacial till in the form of dense clay.)
We have no idea where the smelting of the iron objects took place, and it was almost certainly not at the location of the cache, since objects in direct context including, for example, maize cobs and bison teeth survived intact showing no evidence of heat damage.
Of course, if the center of a 1500 year old tree was burned for the charcoal used in smelting, this would explain the age of the object's carbon component. But given the overall content and context of the artifact cache, recognizing this hypothetical possibility does not in itself seem to warrant declaring "case closed".
You're right, of course, that the dating of more than one object is called for. As I've said before, this is very much a work in progress, and a strictly avocational project. Among many problems is the very limited number of such artifacts in the find, and the fact that the dating process is destructive as well as expensive, up to $600 a shot. I'm sure this will not be resolved quickly, if ever...
Dwarmour, I think I addressed some of your very good questions above (please tell me if I didn't). As to the others:
Yes, as Dave related to me, the objects all appeared together in a layer of creek sand within the glacial till, this sand layer being horizontal and not parallel to the sloping terrain surface. Unfortunately, I did not see the cache intact in situ, but I did later see bits and pieces of the various materials still within the sand. (And as I have said, it's a damn shame that our local taxpayer-funded state archaeological establishment refused to participate in or even witness the artifacts' retrieval, which Dave had to do immediately to meet his commitment in finishing a construction project.)
The glass point, clearly formed/chipped into the shape of an "arrowhead", was right within the concentration of (I think over two dozen) flint, quartz, and calcedony points and blades. No, I have not yet subjected the glass point to testing, but it's on my agenda to haul this and other objects including slag to a lab for XRF spectroscopy analysis ($235 an hour - #@*!), for whatever this might reveal. There has been, I think, some limited success in the hydration dating of glass, but this is quite problematic, and there's no way I'm going to have a hole, however small, drilled into the point.
You might have to see them in person, but the appearance and content of the glass pieces does not suggest formation by a lightning strike. And of course there is the one large glass nodule similar in coloration to the point, and having the definite appearance of artificial but noncommercial manufacture, with what looks like sand and lime embedded in its surface (off to the XRF lab...).
The 90% figure (approximate but close) refers to the probability of the age of the iron's carbon content falling within the range indicated by the graphs' curves. A variation of a few hundred years in the radiocarbon dating of a sample is quite typical, and yes, the apparent age of the temporally diagnostic lithic artifacts is close to this range. I waited for quite a while before posting the numbers, wanting to verify my own understanding of them (still quite basic and undoubtedly questionable), and discuss all this at length with the director of the AMS lab. He is not taking a position on whether or not this indicates prehistoric iron smelting here (nor should he), standing only by the quantitative results from his lab and saying a lot more work needs to be done. Interestingly though, he volunteered on his own that he thinks there is no logical reason to assume Native Americans could not have come upon iron smelting in the course of their experimentation with fire, saying "it's not that difficult".
It's both amusing and rather appalling that in looking at the abundant evidence in North America of smelting in places it is not expected, people always assume this was done by European pioneers of the historic era, or speculate that it was by Viking explorers. It had to be white people, right? We all know Indians lacked the intelligence to melt bog ore, right? Don't tell anyone, but it's well established that Africans in the area of present-day Tanzania were producing carbon steel two thousand years ago; see, for example, http://www.sciencemag.org/cgi/content/abstract/201/4361/1085
Fun stuff...
Regards, Alan
Post ID#6732 - replied 4/9/2008 12:41 PM
FireArch
Moderator
Just so you know, I'm not arguing for "Case Closed" status on this project. I am, however, going to offer counterpoints if I see them, as well as suggestions when needed. For instance, it would be very useful to understand the age of the overlying "glacial till clay" by more than the observation of one geomorphologist. Bulk AMS dating should be able to achieve that goal. I know this stuff is expensive, but when one has an extraordinary case, the obligation is to prove it, and not to dismiss non-believers as mere proponents of archaeological hegemony as others have done here.
A most important detail that should be investigated is whether or not there is any means for this material to have gotten under the clay artificially (e.g., an intrusive trench, an intrusive well shaft, cache pit, etc.). This possible mechanism must be explained away or it must always remain a considered possibility.
Cheers,
Richard
Post ID#6740 - replied 4/9/2008 2:33 PM
scottyj432
Just a thought.
Scott
Post ID#6742 - replied 4/9/2008 4:04 PM
Charlie Hatchett
Abstract
A layer of vesicular blue-green glass occurs in the 12th century-B.C. level of Tel Yin'am. The glass was formed by fusion of plant parts rich in opal phytoliths, and is 75% SiOsub2/sub with a high Ksub2/subO/Nasub2/subO ratio. Surviving plant structures (now converted to tridymite pseudomorphs) indicate that the material fused was from a grain of some type, perhaps wheat beards. The glass layer overlies nests of probable rodent droppings, now converted mainly to aragonite by the heat of combustion. We believe the glass to be the product of accidental burning of a layer of straw or chaff from threshing, though there is still a possiblity of a deliberate attempt at glass manufacture.
An Early Iron-Age Layer of Glass Made from Plants at Tel Yin'am, Israel
Robert L. Folk and G. K. Hoops
Journal of Field Archaeology, Vol. 9, No. 4 (Winter, 1982), pp. 455-466 (article consists of 12 pages)
Published by: Boston University
http://www.jstor.org/pss/529682?cookieSet=1
Post ID#6754 - replied 4/10/2008 4:11 AM
AD
Richard, no problem - I recognized that you were not proposing a Methuselah tree as the only answer (some would, though).
Well reasoned counterpoints are always welcome, and of course quite necessary in matters like this. And, my occasional grumpiness notwithstanding, I'm not a proponent of hegemonies or conspiracy theories, but an accumulation of more mundane things like timidity, fear of disapproval/ridicule, perceived career guarding, etc. do tend to have a similar effect.
I think I was remiss in not adequately explaining the reason for the geomorphologist. The age of the terrain is most likely around 14,000 years since this is roughly when the Wisconsinan glacier departed the area. But that's not really much of an issue here since there was never any speculation that the artifact material was deposited pre-glacier. Almost certainly this was in fact a cache pit containing various valued objects. As I said, these were placed in a layer of quite out-of-place creek sand that was laid horizontal (five feet down) and not parallel to the slope of the terrain. Also, the artifacts were in an area of light underground water flow, characteristic of cache burials since, apparently, those folks had recognized the preservative qualities of such a venue. Hiring the geomorphologist was in response to Ohio Historical Society archaeologists' insistence that the location must be the site of a nineteenth-century landfill. For various well considered reasons we were certain that this was not the case, but wanted independent and professional verification.
Charlie, many thanks for that very interesting paragraph and link to the article on the Israeli finds. It's something to consider, of course, although the glass here is not vesicular and appears in varying colors and compositions, and not as a layer. (I'm sure you find all this interesting in the context of your anomalous and quite intriguing metal finds in the context of very old lithic artifacts. As you know, these seem to be showing up in many places in North America, and deserve more consideration than they have been receiving.)
Israel, with some of the world's best archaeologists, has long been the area of some of the wildest discoveries. Tel Yin'am is (I think) not far from Yifta'el, the Neolithic site where they found perhaps the earliest evidence of superheating technology (calcining in this case) in the form of a large and obviously artificial floor of lime-based cement. (My first real fieldwork experience was in Israel at Tel Arad in the Negev desert - fond memories from long ago...)
Scott, thanks for your observation. Well, some of the metal fragments do "somewhat", as you say, resemble old iron scrap from various sources. But none of the iron artifacts (nor any of the others) have been at all convincingly identified as having the morphology of historical-era utilitarian objects. (We had quite a go-around about this in another discussion thread.) By way of independent observation, I might mention that I ran the photos past an archaeometallurgy professor with a seemingly encyclopedic knowledge of historical-era American iron products. He concurred that the objects' appearance is atypical, and, to my great surprise, recognized quite on his own that some of them were intentionally formed as simple zoomorphs, notably these:

However, he did not like the idea of prehistoric Indians making iron, nor the ancient radiocarbon date, and proposed that a nineteenth-century "prankster" had reheated recent iron scrap to reform it and fashion it into the images, also making concrete nodules that he formed onto the iron, as on the objects in the bottom photo, on which he had curled the ends of the hot iron rods to support them. And then the prankster inserted these among the Native American cache five feet down and covered over the evidence of his activities, carefully smoothing the terrain surface. When asked why anyone would go to so much effort for a joke, he said "People do strange things". How does one argue with that? So, we have another fine hypothesis to consider...
Regards, Alan
Post ID#6767 - replied 4/10/2008 6:38 PM
FireArch
Moderator
Based only on the information given so far, re above, and other threads concerning the same material, my opinion is that you have some relatively modern trash (it would be nice to have mold marks, maker's marks, and other identifiable elements to look at) that was thrown into the noted pit (as a joke or not remains to be explored, but I doubt it was as a joke). I have seen this sort of material in nearly identical settings and the stuff comes out of the hole looking just like your material. In particular, metal objects, especially wire, situated in a sandy matrix, with rocks, in an aqueous solution will definitely oxidize in such a way as to encompass sands and rocks with rust much the same way as the second photo above illustrates.
Cheers,
Methuselah Tree
Post ID#6791 - replied 4/12/2008 12:26 AM
AD
Yes, the rusted iron objects, perfunctorily viewed, do suggest recent trash, but then seen at this level they just as closely resemble buried Roman iron surgical instruments and the stuff that fell from the bottom of my previous truck; it's a safe bet that they are neither. So we still can't say from outward appearance just what they are or how old they are - hence the attempt at radiocarbon dating, etc... You can be sure that if anything like an embossed maker's mark had been present on any of the metal, speculation about an unadulterated Native American cache burial would have ceased immediately. To the best of our ability, we check everything out carefully and objectively.
I know what you mean about oxidized material fusing with what surrounds it, and have seen it in other contexts. But this is quite different from what we're seeing here, which is in fact manufactured cement/concrete. We submitted several relatively expendable samples of this to a fellow who specializes professionally in the analysis of such materials (equipped with SEM, etc.), who determined that it is a cement produced by the calcining of lime, and is of natural materials as opposed to being a recent synthetic product. The morphology of much of the concrete material is not at all consistent with random commercial scrap, the best example being this one:
Maybe you see something striking in this, maybe not. Apropos, you might take a look at my posting and the ensuing discussion at http://www.archaeologyfieldwork.com/forums/viewtopic.php?t=2842 (note that this extends into a second page).
Thanks for those observations and suggestions. Of course honest and considered attempts at "falsification" are required for an extraordinary hypothesis.
Regards, Alan
Post ID#6797 - replied 4/12/2008 5:35 AM
Heather626
Post ID#6836 - replied 4/13/2008 1:02 AM
AD
With all due respect, you really should focus more on your speciality of osteology - you're good at that. Construction materials definitely are not your forte. The thick and hard material encasing some of the iron rods is definitely concrete, not rust. I've had plenty of experience with rust and know what it is.
Also, an identifying characteristic of nails, not present in this material, is that there is a point at one end and a perpendicular flattened surface at the other to facilitate their being hammered into a softer material. Quite aside from the presence or absence of a flat head, a nail is not curled at one end, as this would be detrimental to its intended purpose.
An illustration of the juxtaposition of iron and concrete in a single object is presented by the following two close-ups of one of the artifacts. Note that about five millimeters of iron protrudes from the end, not significantly oxidized and quite distinct from the encasing concrete. (And perhaps you will even notice something intriguing in the morphology of the iron component.)
AD
Post ID#6847 - replied 4/13/2008 7:07 AM
Heather626
Post ID#6860 - replied 4/14/2008 3:47 AM
AD
Thanks for the clarification - we're closer to being on the same page... (And of course I wish my own spell checker would tell me when I'm using the wrong word.)
The nail photos from Jamestown are quite interesting, but they do not show the same thing by any means. Aside from the staples and the top two objects (whatever they are), these clearly are nails with the requisite flat heads. The curves and curls on some of them are at the pointed ends, the result, I would conjecture, of the nails being pounded against a harder surface behind a board or whatever. None of the iron rods among the artifacts at this site have flat heads, and those rods with end curls (a bit long and narrow for nails anyway) have these at unpointed ends, and on two of them the curls are encased in individually affixed cement nodules. In the context of construction materials, what utilitarian purpose could this possibly have served?
None of the rods are "wire" in the sense of material that can be easily twisted. Beneath a thin layer of rust they are hard and rigid iron, clearly curved/curled while still hot during the manufacturing process, evidently to support the roundish cement nodules. Note this photo of the back of the nodule on the middle piece, showing the end of the iron curl protruding from it perpendicular to the rod as a whole (in the photo, top middle, more or less):
It sounds as if your colleagues' line of reasoning runs something like this: "The object in question is metal, long, and narrow. Nails are metal, long, and narrow. Therefore the object in question is a nail." Convenient if one prefers not to think very much, but it leaves a lot of room for skepticism.
And of course there remains the AMS dating of the iron's carbon content that places it near the age of the Native American lithic artifacts in context - not fully conclusive in itself, but nonetheless a factor in the equation.
Regards, AD
Post ID#6871 - replied 4/14/2008 2:22 PM
Heather626
Post ID#6885 - replied 4/14/2008 9:19 PM
Charlie Hatchett
He concurred that the objects' appearance is atypical, and, to my great surprise, recognized quite on his own that some of them were intentionally formed as simple zoomorphs, notably these:

__________________________________________________
Complete B.S. Give me the archaeometallurgy professor's name and contact info. :roll:
Post ID#6886 - replied 4/14/2008 10:23 PM
Charlie Hatchett
Alan Day wrote:
And of course there remains the AMS dating of the iron's carbon content that places it near the age of the Native American lithic artifacts in context - not fully conclusive in itself, but nonetheless a factor in the equation.
The report which you've failed to post. Are you hiding something? :?
Post the full report, including the author's name and contact info, or get lost. :wink:
Post ID#6976 - replied 4/18/2008 1:20 PM
AD
The actual report arrived in the form of a table of the lab's raw numeric data. If you require this, just say so, and I can post an image of it sometime this weekend (have my hands full at the moment). (Perhaps you have written your own calibration software based on your own atmospheric curve, or think you can just process the data more accurately in your head.) I'm being honest in presenting what I have, not "hiding something" as you say. Speaking of which, the raw data does show two "outliers", these being a date of 9252 BP rejected because of the very small carbon content in that sample, and one of 903 BP considered questionable because of its high standard error.
In re-reading the first posting, note that I do give the source of the report as the University of Arizona's AMS lab. You can easily obtain their phone number from the internet if you want to call them and complain.
Again (as if this should be necessary), I'm just presenting the lab's data so far, one factor in a very complex equation.
Incidentally, considering that iron smelting is well documented as taking place thousands of years ago in Europe, Asia, and Africa, do you think the idea that Native Americans might have been doing this is implausible? What I usually hear is that "Indians" just weren't capable of such a technology. Is this your take on it?
AD
Post ID#6978 - replied 4/18/2008 10:09 PM
Charlie Hatchett
The actual report arrived in the form of a table of the lab's raw numeric data...I'm being honest in presenting what I have, not "hiding something" as you say. Speaking of which, the raw data does show two "outliers", these being a date of 9252 BP rejected because of the very small carbon content in that sample, and one of 903 BP considered questionable because of its high standard error
AD
[quote:="AD"]
Three readings from the carbon content (presumably charcoal fuel used in the smelting process) taken from separate samplings of the object indicate about a 90% probability of origin somewhere between 209 and 783 AD, the two more closely corresponding readings indicating 209 to 551 AD, altogether corresponding more or less to the Middle Woodland Period.
How many readings were provided to you? Please do post the full report, including all readings provided to you. What are the lab sample numbers? Also, please provide the lab tech(s) name and contact info. I'd like to chat with the individual(s).
And what about this:
[quote:="Charlie Hatchett"]Alan Day wrote:
He concurred that the objects' appearance is atypical, and, to my great surprise, recognized quite on his own that some of them were intentionally formed as simple zoomorphs, notably these:

__________________________________________________
Complete B.S. Give me the archaeometallurgy professor's name and contact info. :roll:
Post ID#6980 - replied 4/19/2008 5:24 AM
AD
I'm surprised that this is necessary. Given your status in the scientific community, it seems almost inconceivable that any laboratory would release its findings before running them past you for your assessment and approval.
Before I respond further in this matter, I expect you to answer the question I just asked you:
Incidentally, considering that iron smelting is well documented as taking place thousands of years ago in Europe, Asia, and Africa, do you think the idea that Native Americans might have been doing this is implausible? What I usually hear is that "Indians" just weren't capable of such a technology. Is this your take on it?
Also, please do me and everyone else a big favor, at least in this discussion thread, by not repeatedly and moronically re-posting large photos that everyone has just seen. Thanks.
I may not get back to you for a day or two as I have some radio tower repair jobs to complete (need all the $ I can get).
AD
Post ID#6984 - replied 4/19/2008 10:24 AM
Charlie Hatchett
So no overlap of any of the dates...They're all over the place.
Post ID#6986 - replied 4/19/2008 12:35 PM
Heather626
I don't think anyone has said its implausible... we are saying the things you are presenting as evidence of such an activity just aren't so.
Post ID#6987 - replied 4/19/2008 3:53 PM
Charlie Hatchett
I don't think anyone has said its implausible... we are saying the things you are presenting as evidence of such an activity just aren't so.
My opinion, precisely.
Post ID#6988 - replied 4/20/2008 4:13 AM
AD
Charlie wrote:
So no overlap of any of the dates...They're all over the place.
So what was the point in your demanding the raw numeric data? Rather than copying and posting this, I could have achieved the same effect with less time and effort by simply printing it out and showing it to a cow. You clearly have no comprehension of what you are seeing. The raw "14C age BP" is not like the number you get when taking your temperature or puffing into a breathalyzer. If you had understood what I've presented twice in this discussion thread, you would have realized that this needs to be processed through software that calibrates it to a historic atmospheric curve, yielding a graph of probability distribution as shown in my first posting. That's how it's done. You will note that the first two probability curves overlap quite nicely, and that the third deviates by roughly two hundred years, very much par for the course in radiocarbon dating. (And as I also said earlier, the dating of iron is particularly tricky.) Since you do not retain information from one posting to the next, even when it is still there and quite readable, I better reiterate that, as was explained to me by a fellow at the lab who quite likely knows more about this than you or I, the bottom two "14C age BP" dates (older and more recent) are statistical outliers, and the top three more likely represent the age of the sample's carbon content. And as always, it's not a matter of absolute certainty, but of probabilities.
If you want to discuss radiocarbon dating in anything approaching an intelligent manner, you might start by reading some introductory material on the subject. Wikipedia's presentation of this is pretty good and relatively nontechnical. Just concentrate on it for a while and you may understand some of it. In particular, note the section on calibration, where they begin by saying "A raw BP date cannot be used directly as a calendar date, because the level of atmospheric 14C has not been strictly constant during the span of time that can be radiocarbon dated."
DesertRat wrote:
...should I announce this paradigm-shattering discovery to the world...
I'm doing nothing of the kind - just reporting the current status of an ongoing investigation. And you might re-read the discussion to see that I said "...one can say with certainty only that these are the numbers returned by the radiocarbon dating process" and "Altogether, there remains a lot of time-consuming and expensive research to be done". Of course as Heather626 said, we could save a lot of time and money by accepting at face value her assertion that it's all nails, but then the saying comes to mind that when all one has is a hammer, everything looks like a nail. Speaking of which, below is a photo of five iron artifacts without adhering concrete, since this material causes DesertRat to become even more confused than he usually is. Without this complicating factor, do all three of you think these are nineteenth-century nails? Please explain your reasoning.
Heather626, thanks for filling in for Charlie on the question of the plausibility of Native American iron smelting. However, I was actually asking for his thoughts on the matter, and since you spoke up first he quite reflexively responded "My opinion, precisely", his stock reply to a professional when he has switched into sycophant mode. I'd still like for him to elaborate on what he thinks, and the reasoning behind this.
With other commitments, I may be a bit slow in returning to all this. Thanks, and I'm looking forward to your responses.
Later... AD
Subsequent edit: Since this discussion thread ended rather ignominiously before I got around to commenting on the identification of the iron objects shown above, I'd now (rather belatedly) like to point out that DesertRat and two other "professionals" (see following postings) have identified as obvious recently manufactured nails surgical implements recovered from a Roman/British grave at Colchester dating to about 50 AD. This seems to be a lesson in the folly of immediately and unthinkingly confusing/conflating an unknown object with something with which one is familiar, based on a quite superficial resemblance - an error that occurs with alarming frequency in this forum of persons claiming a "scientific" mindset.
Post ID#6991 - replied 4/20/2008 1:26 PM
scottyj432
Item #2 appears to either a 9 or 10 penny nail.
Item #4 appears to be a 16 penny nail.
An example of nail sizes can be found:
www.sizes.com/tools/nails.htm
An extensive bibliography on nails on researching nails in historical archaeology:
www.digitalpresence.com/histarch/nails.html
Scott
Post ID#6995 - replied 4/20/2008 6:59 PM
sierra918
Post ID#6999 - replied 4/21/2008 1:16 AM
scottyj432
They (Native Americans in the prehistoric past) were a heck of a lot smarter than even some anthropologists/archaeologists (today) give them credit for.
The fact of matter is there has been a tremendous amount of testing and full scale excavations conducted at Native American prehistoric sites throughout North America.
As far as I am aware, there has never been any evidence from these extensive investigations to even remotely suggest that there were "iron-smelting" activities associated with North American Native Americans.
I may be wrong in this and if so, then those who disagree can fling all the arrows they want.
But, I think the point is this: A set of data has been presented here in this thread. And while this data has been subjected to a certain level of scientific analysis, it is in fact somewhat tenuous at best.
These artifacts, when they were recovered, have virtually no documentation regarding the context in which they were found.
Several "suggestions" have been proposed here as an interpretation of the photo images posted on this site.
All of those "suggestions" or "interpretations" or whatever you want to call it have been outright dismissed.
BUT.....if one is to propose an "idea", "theory" or "hypothesis", then it becomes open to scrutiny/critique:
It is called "critical thinking".
That has repeatedly been rejected here.
The photo images that have been posted here are all suggestive of a late 19th to early 20th century context.
Scott
Post ID#7001 - replied 4/21/2008 1:44 AM
FireArch
Moderator
To paraphrase Huxley after reading Darwin's manuscript for Origin of Species, "How incredibly stupid not to have thought of that myself." I never saw that as a joke in the movie, and I should have. Damn.
Post ID#7002 - replied 4/21/2008 1:55 AM
FireArch
Moderator
Post ID#7008 - replied 4/21/2008 12:28 PM
Charlie Hatchett
Charlie wrote:
So no overlap of any of the dates...They're all over the place.
So what was the point in your demanding the raw numeric data?
I didn't ask for just the raw numeric data:
[quote:="Charlie Hatchett"]
Alan Day wrote:
And of course there remains the AMS dating of the iron's carbon content that places it near the age of the Native American lithic artifacts in context - not fully conclusive in itself, but nonetheless a factor in the equation.
The report which you've failed to post. Are you hiding something? :?
Post the full report, including the author's name and contact info, or get lost. :wink:
I'd like to read the author's comments and chat with the individual personally. You've told what I interpret to be "untruths' in the past, so lets just say I don't trust you:
[quote:="Charlie Hatchett"]Alan Day wrote:
He concurred that the objects' appearance is atypical, and, to my great surprise, recognized quite on his own that some of them were intentionally formed as simple zoomorphs, notably these:

__________________________________________________
Complete B.S. Give me the archaeometallurgy professor's name and contact info. :roll:
Have the projectile points, that were supposedly found in the same context as the metal trash, been authenticated by anyone reputable?
Post ID#7026 - replied 4/22/2008 3:25 AM
AD
FireArch wrote:
There are chemical composition differences between irons and steels across time and space, and it should be very easy to back up the 14C dates that have been figured in the earlier test if they are indeed iron products - as opposed to steel, which requires a much more elaborate technology.
Hi FireArch, thanks for your observation, as usual considerably more relevant than most of the others'. Yes, there remains a lot of analytical work to be done (preferably nondestructive), as resources permit. (And I'm trying to learn about metallurgy, still woefully uninformed.) The distinction between iron and steel seems to be a bit more nebulous than one might think, though, and the technology for producing the latter is not necessarily more complex. The difference is primarily in the carbon content. Wikipedia (always infallible, of course) defines steel as "an alloy consisting mostly of iron, with a carbon content between 0.2 and 1.7 or 2.04% by weight... depending on grade". In my most recent discussion with the director of the AMS lab, he told me the carbon content of the tested sample varied from one segment to another, one showing 0.007%, another 2.2%, and the rest in the range of 0.04% to 0.08% - so it's hardly homogeneous. Historically, going back 2000 years, steel was sometimes produced even by the direct reduction (i.e., bloomery) process. (From "The Radiocarbon Dating and Authentication of Iron Artifacts" [Craddock, Wayman, and Jull].) And Africans, by means of a bellows-driven superheating process, consistently produced steel a very long time ago.
From a summary of an article in the journal Science (Schmidt and Avery), 27 May 2005 :
Western scientists and students of history have long explained the iron bloomery process by evidence available from European archeology. Ethnographic, technological, and archeological research into the technological life of the Haya of northwestern Tanzania show that these people and their forebears 1500 to 2000 years ago practiced a highly advanced iron smelting technology based on preheating principles and, as a result, produced carbon steel.
I wish all this were simpler, but it sure isn't...
scottyj432, thanks for those very helpful links. (Actually, I stumbled upon these a while back, during an earlier discussion of "nails".)
You wrote:
Several "suggestions" have been proposed here as an interpretation of the photo images posted on this site.
All of those "suggestions" or "interpretations" or whatever you want to call it have been outright dismissed.
BUT.....if one is to propose an "idea", "theory" or "hypothesis", then it becomes open to scrutiny/critique:
It is called "critical thinking".
That has repeatedly been rejected here.
As written, this is a bit of a semantic Rorschach test, but I agree that critical thinking has, among many of the participants in this discussion, gotten the short end of it. When I (quite unexpectedly) jumped back into archaeology after a thirty-year career in research and development (electronics), I experienced quite a "culture shock". The prevailing understanding of the scientific method here seems (with a few notable exceptions) to be that one starts with an a priori conclusion and then works back through available evidence, interpreting this in a manner supportive of the conclusion. And there seems to be little understanding of the difference between hypothesizing and postulating (easily acquired by referring to a dictionary). I am currently hypothesizing that Native Americans, at some point in time (Early Woodland Period?), engaged in iron smelting and other high-temperature technologies for production not of utilitarian tools but of symbolic objects, and that this practice and technology fell by the wayside during the cultural decline marking the transition from Middle to Late Woodland when this time-consuming and labor-intensive but unpragmatic practice was discarded as survival-related activities became paramount (hence the lack of testimony to this by early European explorers). Of course this hypothesis, like any other, must be subjected to an honest attempt at "falsification", and I thank you all for your attempts at this. And further in this process, the hypothesis must be tested for predictability, e.g. replicability, in this case the same archaeological phenomenon identifiably appearing in other locations.
sierra918 wrote:
I am curious to know whether there have been similar artifacts recovered from chronologically similar contexts that have been deemed disturbed because the researchers did not date the materials and because, as previously stated, people refuse to believe that Native Americans could have accessed this level of technology. Does anyone know of any such examples?
Thanks for that insightful and provocative question. You must still be at least relatively young (which I probably am not). Aside from the Dave Gillilan cache (1.5 m down), I am not personally aware of venues in which such material has appeared in unequivocal context with temporally diagnostic artifacts, but in the immediate area of that find is the huge Hopewell mound complex at Chillicothe, Ohio, where evidence of smelting (both slag and sometimes iron) has for decades or longer been noted in surface and near-surface context with clear evidence of very early human activity. For one example (among many others), there is the Spruce Hill walled earthworks site (presumed Hopewell), at which vitrified rock (so I've been told by many people - I haven't seen it yet) has been found in considerable quantity at at least one spot along the wall on this 300-foot-high mesa-like topological formation. Local archaeologists laughingly dismiss this as an "intrusive feature", asserting that it must be from early pioneers who, for some reason, climbed up there to smelt iron rather than do this at the settlements in the valley. (Maybe they did, of course.) There is apparently a lot to be seriously investigated in that general area, but it probably will not be because of the preconceptions you noted (had to be white people, etc.). (I should note that all this is about a two-hour drive from where I live, and that the Gillilan find is a project secondary to my own local one in Guernsey County.)
Heather626, I'd really like to hear your assessment of the five iron objects I most recently showed. Thanks!
As always, I'll probably be slow in replying - can't help it...
Regards, AD
(Edited 5 Oct. '08 to correct typo - inadvertently wrote "Early" rather than "Middle".)
Post ID#7027 - replied 4/22/2008 2:20 PM
Heather626
1. Nail
2. Larger nail or rod... like a dowel rod - we use iron rods like that for marking out units or TBMs
3. looks like a butter knife I once excavated from an historic lighthouse in Erie, PA... but that could just be the initial shape throwing me in that direction, could very well be something like a door hinge or other flat metal object.
4. same as #2
5. same as #2
Again, we take the crap off the metal to see what it is. Part of the artifact processing process... Also, what scale is that? inches or centimeters? I'm taking for granted that its centimeters, but can't tell.
Post ID#7028 - replied 4/22/2008 3:07 PM
FireArch
Moderator
Hi FireArch, thanks for your observation, as usual considerably more relevant than most of the others'. Yes, there remains a lot of analytical work to be done (preferably nondestructive), as resources permit. (And I'm trying to learn about metallurgy, still woefully uninformed.) The distinction between iron and steel seems to be a bit more nebulous than one might think, though, and the technology for producing the latter is not necessarily more complex. The difference is primarily in the carbon content. Wikipedia (always infallible, of course) defines steel as "an alloy consisting mostly of iron, with a carbon content between 0.2 and 1.7 or 2.04% by weight... depending on grade". In my most recent discussion with the director of the AMS lab, he told me the carbon content of the tested sample varied from one segment to another, one showing 0.007%, another 2.2%, and the rest in the range of 0.04% to 0.08% - so it's hardly homogeneous. Historically, going back 2000 years, steel was sometimes produced even by the direct reduction (i.e., bloomery) process.
True and not so true. Yes the conceptual difference between a steel and an iron is carbon percentage, but more importantly is the means of creating steel. Steel needs to be a more pure alloy - as you rightly termed it - and that requires superheating of the metal to drive off those impurities (see Huntsman or Sheffield steel), or by oxygenating (as you noted with the African example) the bloom with the bessemer process (http://en.wikipedia.org/wiki/Bessemer_process).
More importantly, a metallurgical investigation will tell you the composition of the minor elements in the metal alloy and this should give you a better understanding of the time period in which the metal items were manufactured as well as to their purpose.
Post ID#7029 - replied 4/22/2008 4:41 PM
Charlie Hatchett

Looks like a spoon.
Have the projectile points, that were supposedly found in the same context as the metal trash, been authenticated by anyone reputable?
They could be post contact. The metal and glass stuff could have been obtained via trade with local settlers.
...Dave Gillilan cache (1.5 m down)...unequivocal context...
Unequivocal context? You never saw the stuff in situ, so how did you come to this conclusion? And this was a competely uncontrolled "dig".
Of course, you've got a habit of jumping to conclusions:
A "Pre-Clovis" Site in Ohio? This is a presentation of artifacts from a potential pre-Clovis habitation site in southeastern Ohio.
www.daysknob.com/
unequivocal:
1 : leaving no doubt : clear, unambiguous
2 : unquestionable
http://www.merriam-webster.com/dictionary/unequivocal
And since no in situ shots were taken, how do we really know the two were in the same stratigraphic context. The metal and glass stuff could easily have been buried in a hole that cut through the strata containing the projectile points (an inset). Growing up, my grandparents burned their trash and buried whatever didn't burn...metal, glass, etc...
Post ID#7086 - replied 4/25/2008 3:25 PM
AD
The metal and glass stuff could easily have been buried in a hole that cut through the strata containing the projectile points (an inset). Growing up, my grandparents burned their trash and buried whatever didn't burn...metal, glass, etc...
Ok, I'll take your word for it that when your grandparents were growing up they emptied their trash can by digging a hole five feet deep and several feet across, spreading the trash in a thin layer at the bottom, then filling in the hole and smoothing the surface over. That's pretty labor-intensive, but apparently back then parents really knew how to keep their kids busy.
Looks like a spoon.
Here's a closer look at the object you circled. I don't know what it is, but it's no more a spoon than the other iron pieces are nails. It's roughly 8 cm (3") in length, with two pebbles firmly affixed, apparently with natural lime-based cement.

Have the projectile points...been authenticated by anyone reputable?
They could be post contact.
Of course they have. The clerk at the WalMart store where we bought them told us they were real. Since you think they could be of post-contact manufacture, please give us your expert assessment. They are shown in these photos:
http://www.daysknob.com/images/DGFQ01.JPG
http://www.daysknob.com/images/DGFQ02.JPG
http://www.daysknob.com/images/DGFQ03_600.jpg
http://www.daysknob.com/images/RNDBAS.JPG
AD
Post ID#7088 - replied 4/25/2008 4:37 PM
Charlie Hatchett
http://www.daysknob.com/images/DGFQ01.JPG
http://www.daysknob.com/images/DGFQ02.JPG
http://www.daysknob.com/images/DGFQ03_600.jpg
http://www.daysknob.com/images/RNDBAS.JPG
AD
I have no idea. Do you? :?
You'd think you would have checked that first. :wink:
However, the stone specimens may have nothing to do with the metal. Any iron staining on any of them? Any sign of thermal alteration?
...spreading the trash in a thin layer at the bottom...
How do you know this? Did you see the specimens in situ? Any images?
...The clerk at the WalMart store where we bought them told us they were real...
Wouldn't doubt it, with the bunk you've been dishing out. :wink:
Face it Alan: you have absolutely no case for prehistoric iron smelting or glass manufacture. Context is everything, and you have no context whatsoever.
Post ID#7091 - replied 4/26/2008 3:07 AM
AD
I have no idea.
That's what I thought. Sometimes it's fun to ask a question to which I know the answer, just to see what comes back. FYI, here's an old e-mail from Dr. Jonathan Bowen, formerly an archaeologist with the Ohio Historical Society and recommended by them (e-mail addresses omitted for obvious reasons):
Thanks again for the opportunity to see your photos, Alan!
As you say, the stuff looks like mostly Late Archaic from Ohio and the SE
US, perhaps western VA, NC, or SC.
Best wishes
JEB
----- Original Message -----
From: "Alan Day"
To: "Jonathan Bowen"
Sent: Monday, July 17, 2006 7:16 PM
Subject: Points and Blades Query
> Dear Dr. Bowen,
>
> You have been recommended to me as an expert on the typology and
> distribution of flint points and blades. If you have time, I would
> greatly appreciate your taking a look at the attached photos of flint and
> quartz objects found buried as a cache about 1.5 meters beneath the
> surface of apparently undisturbed terrain in southeastern Pickaway
> County, Ohio. The consensus so far is that they are generalized Archaic,
> the flint being at least in part from Ohio (Upper Mercer), and the quartz
> from the southeastern US. Perhaps you could narrow down the likely
> temporal association a bit, and/or provide some other insight.
>
> An interesting object in direct context was the 57 mm tooth shown in the
> third and fourth photos, identified by several vertebrate zoologists as a
> bison molar, its distinctively characteristic feature being the isolated
> stylid visible in the fourth photo.
>
> Thank you very much for your time and consideration.
>
> Sincerely, Alan Day Cambridge, Ohio
The one anomalous point shown at http://www.daysknob.com/images/RNDBAS.JPG is a classic Adena "beaver tail", more or less Early Woodland, so it seems reasonable to think that the cache as a whole was not deposited during an earlier time period.
...the stone specimens may have nothing to do with the metal.
Quite likely not, other than that they were buried together, seemingly at the same time. Likewise the bison teeth, the pottery, the maize, etc.
...you have no context whatsoever.
Wrong, unless Dave is lying as you seem to suggest. I've known him for about two and a half years now, and can say with confidence that he is an honest man. He is also intelligent and quite knowledgeable about materials in general, so even if he were to perpetrate a hoax it certainly wouldn't be anything this incredibly messy. And considering your behavior in the past couple years, I find it a bit odd (or maybe not) that you are so quick to call other peoples' integrity into question.
Once again, as I have said many times, I am just reporting the current status of this strange project - no more, no less. And there remains a lot of work to be done. Kindly don't bug me again about the lack of professional execution initially. I've explained the reason for this repeatedly. We are painfully aware of the problems, but one can only keep moving from wherever one happens to find oneself. Worst case, what we have here at least contributes to the replicability factor as further evidence of prehistoric iron smelting appears in other venues.
AD
Post ID#7092 - replied 4/26/2008 12:34 PM
Charlie Hatchett
I have no idea.
That's what I thought. Sometimes it's fun to ask a question to which I know the answer, just to see what comes back
Ahhhh...very sneaky, Alan. :wink:
...you have no context whatsoever...
...Wrong, unless Dave is lying as you seem to suggest...
Not lying, just not aware of what context means. In situ does not mean a bunch of loose artifacts at the bottom of a hole dug by a backhoe. Those artifacts could have come from near the surface to near the bottom of the hole...who knows? Same with the metal and glass specimens. And since no images were taken we'll never know unless you guys get out there and dig again and properly document any in situ finds.
The one anomalous point shown at http://www.daysknob.com/images/RNDBAS.JPG is a classic Adena "beaver tail", more or less Early Woodland, so it seems reasonable to think that the cache as a whole was not deposited during an earlier time period.
How do you know all the artifacts are temporally associated? Again, there's no context, so it does not seem reasonable to call all the artifacts a cache. The Late Archaic Period spans a couple of 1,000 years prior to the Early Woodland.
Quite likely not, other than that they were buried together, seemingly at the same time. Likewise the bison teeth, the pottery, the maize, etc.
You have no way of knowing this. There's no documentation of the artifacts in situ. Didn't someone here on the board identify the pottery as 19th century. Bison and maize were both abundant in the 19th century.
Worst case, what we have here at least contributes to the replicability factor as further evidence of prehistoric iron smelting appears in other venues.
How do your out of context bits of rusted metal constitute evidence for prehistoric iron smelting. If you have no evidence for prehistoric iron smelting how does this stuff demonstrate replicability.
Post ID#7095 - replied 4/27/2008 2:40 AM
AD
This is indeed a tolerant forum (good thing for me, I'm sure), and I think it must be one of few that have not booted you out by now. A case in point is christianforums.net:
----------------------------------------------------------------------

----------------------------------------------------------------------
You then proceeded to spam and harass anyone that didn't agree with you, until it finally came to this:
----------------------------------------------------------------------

----------------------------------------------------------------------
You're a classy guy, Charlie...
AD
Post ID#7096 - replied 4/27/2008 9:30 AM
Charlie Hatchett
This is indeed a tolerant forum (good thing for me, I'm sure), and I think it must be one of few that have not booted you out by now. A case in point is christianforums.net:
----------------------------------------------------------------------

----------------------------------------------------------------------
Doesn't seem to bother you a bit (though I wish you would remove any reference to me or my research on your site...I really don't want any of my research associated with your tripe):
In Texas, Charlie Hatchett has recently found a couple simple metallic bird forms and what is thought may be part of a furnace cut into limestone bedrock.
http://www.daysknob.com/DG.htm
Charlie Hatchett Finds
Central Texas, near the Wilson-Leonard Site
After viewing this website, Charlie Hatchett in Austin has found some interesting artifacts along a stream in an area of Texas that has long been the subject of pro- fessional investigation. His finds include material diagnostic of several time per- iods, but also including lithic artifacts quite similar to those at the Day's Knob site. Of particular interest at his site are apparently manmade objects of metal- bearing material, along with clearly artificial cavities in limestone bedrock that are somewhat suggestive of a smelting furnace. Charlie has recently started his own website showing his finds:
http://cayman.globat.com/~bandstexas.com/preclovisindians.html
Classic bifrontal image; quasi-anthropomorphic face at right end, bird head left.
Above: Note the distinct bird head at the left end of this implement, and the more abstract one at the right. Below: This same tool shown beneath one of similar form and size from Day's Knob.
Anthropomorphic faces on simple tools.
Apparently a bird-form pendant, length 5 cm (2").
Another pendant, 11.5 cm (4.5").
A feature carved into limestone bedrock, with an appearance suggesting use as a smelting furnace.
Apparently manmade iron-bearing bird figures, very interesting in the con-text of the furnace-like structure.
http://www.daysknob.com/CH.htm
Psssst, guess what Alan? :?
Everyone here already knows I'm a creationist. :wink:
I don't hide it.
This is called integrity, Alan:
Main Entry: in·teg·ri·ty
Pronunciation: \\in-ˈte-grə-tē\\
Function: noun
Etymology: Middle English integrite, from Middle French & Latin; Middle French integrité, from Latin integritat-, integritas, from integr-, integer entire
Date: 14th century
1 : firm adherence to a code of especially moral or artistic values : incorruptibility
2 : an unimpaired condition : soundness
3 : the quality or state of being complete or undivided : completeness
synonyms see honesty
http://www.merriam-webster.com/dictionary/integrity
Firearch actually had to delete a thread between me and Kidcharlemagne because I tore his idiotic ToE arguments to shreads.
I'm your Huckleberry:
http://www.youtube.com/watch?v=Nx1TWk-V4P0&feature=related
Point is: I have nothing to hide, whereas you appear to:
[quote:="Charlie Hatchett"]
I'd like to read the author's comments and chat with the individual personally. You've told what I interpret to be "untruths' in the past, so lets just say I don't trust you:
Alan Day wrote:
He concurred that the objects' appearance is atypical, and, to my great surprise, recognized quite on his own that some of them were intentionally formed as simple zoomorphs, notably these:

__________________________________________________
Complete B.S. Give me the archaeometallurgy professor's name and contact info. :roll:
Now you resorted to an attempted smear campaign because you have nothing objective left to your argument (It's sad someone would resort to such tactics ;) ).
You then proceeded to spam and harass anyone that didn't agree with you, until it finally came to this:
----------------------------------------------------------------------

----------------------------------------------------------------------
You're a classy guy, Charlie...
AD
Yup. Vic and Slevin: two ardent atheists. You forgot to post the good part:
by The Barbarian on Mon Oct 16, 2006 2:54 pm
The same argument would rule out a baby growing into an adult. Clearly, a lot of creationists have no grasp on the concept of entropy."Beware of gifts bearing Greeks." - Laocoon
by Charlie Hatchett on Mon Oct 16, 2006 6:30 pm
Clearly, a lot of creationists have no grasp on the concept of entropy.
From an individual who equates information with entropy.
(Barbarian demonstrates how a new allele increases information by increasing uncertainty)
Yep, but you need to be reminded, it seems. Let's get you a definition of "information" that can actually be tested...
The quantity which uniquely meets the natural requirements that one sets up for information turns out to be exactly that which is known in thermodynamics as entropy. It is expressed in terms of the various probabilities involved--those of getting to certain stages in the process of forming messages, and the probabilities that, when in those stages, certain symbols be chosen next. The formula, moreover, involves the logarithm of probabilities, so that it is a natural generalization of the logarithmic measure spoken of above in connection with simple cases.
To those who have studied the physical sciences, it is most significant that an entropy-like expression appears in the theory as a measure of information. Introduced by Clausius nearly one hundred years ago, closely associated with the name of Boatzmann, and given deep meaning by Gibbs in his classic work on statistical mechanics, entropy has become so basic and pervasive a concept that Eddington remarks The law that entropy always increases - the second law of thermodynamics - holds, (Charlie: This is true) I think, the supreme position among the laws of Nature.
http://www.uoregon.edu/~felsing/virtual_asia/info.html
Now, you may not like that definition, but it turns out to be the right one. It works. This understandning of information allows us to measure information in things like genetics, data transmission, and so on, and it tells us how to make low-powered transmitters that work over millions of miles, and how to stuff the maxium amount of reliable messages into a data channel.
Given that Shannon's definition works, and yours does not, I don't think youi're going to have much luck in convincing engineers and scientists to go with yours.
Barbarian on why a new allele produces new information:
Yep. All it has to be, is different than the other four. Before we go any further, perhaps you should tell us what you think "information" is, so we can clear up any misunderstandings.
Charlie:
Information does not = entropy.
Barbarian:
Yep, it does. See above.
Charlie:
Information is always a measure of the decrease of uncertainty at a receiver (or molecular machine).
Barbarian:
The quantity which uniquely meets the natural requirements that one sets up for information turns out to be exactly that which is known in thermodynamics as entropy.
Quote:
Your equating randomness with information...that's wrong.
You're confusing entropy with randomness. That's wrong. A system at maxium entropy cannot have any randomness whatever, since that would decrease entropy. Remember in a physical sense, entropy is the lack of any useful heat to do work. And if the thermal energy in a system is randomly distributed, it is not evenly distributed, and therefore heat continues to flow.
Barbarian asks:
So, you're saying that a new allele can't appear in a population? That's demonstrably false. Would you like some examples?
Quote:
I never claimed that new "alleles" don't appear in populations, but I maintain their mutations, which degrade the original information content.
Barbarian:
As you just learned, a new allele increases information. Always does. This is what Shannon was pointing out. Information is the measure of uncertainty in a message. The entropy, in other words.
Charlie:
Again, your confusing randomness with information. That's wrong.
Barbarian:
No. Rather, you've conflated entropy and randomness.
Quote:
And how do you know that “allele” is new?
Barbarian observes:
We can sometimes know, by tracing down the individual in which the mutation occured.
Quote:
Right...a mutation.
Remember, a mutation is not an allele.
Barbarian observes:
Yes, he does. Again, you probably don't know what "information" means in population genetics and information science.
No. The second one has more information, because the uncertainty is increased.
Charlie:
Information does not = entropy.
Barbarian:
If that were so, you wouldn't be communicating over this line. Engineers built that system, with the understanding that information = entropy. That works. Yours doesn't.
Charlie:
By stating information = randomness, you are demonstrating that you don't have a grip on information theory.
Barbarian:
See above. Entropy is not randomness.
Barbarian:
One more time, just so you remember:
The quantity which uniquely meets the natural requirements that one sets up for information turns out to be exactly that which is known in thermodynamics as entropy.
Information Is Not Entropy,
Information Is Not Uncertainty!
Dr. Thomas D. Schneider
National Institutes of Health
National Cancer Institute
Center for Cancer Research Nanobiology Program
Molecular Information Theory Group
Frederick, Maryland 21702-1201
toms@ncifcrf.gov
http://www.ccrnp.ncifcrf.gov/~toms/
There are many many statements in the literature which say that information is the same as entropy. The reason for this was told by Tribus. The story goes that Shannon didn't know what to call his measure so he asked von Neumann, who said You should call it entropy ... [since] ... no one knows what entropy really is, so in a debate you will always have the advantage' (Tribus1971).
Shannon called his measure not only the entropy but also the "uncertainty". I prefer this term because it does not have physical units associated with it. If you correlate information with uncertainty, then you get into deep trouble. Suppose that:
information ~ uncertainty
but since they have almost identical formulae:
uncertainty ~ physical entropy
so
information ~ physical entropy
BUT as a system gets more random, its entropy goes up:
randomness ~ physical entropy
so
information ~ physical randomness
How could that be? Information is the very opposite of randomness!
The confusion comes from neglecting to do a subtraction:
Information is always a measure of the decrease of uncertainty at a receiver (or molecular machine).
If you use this definition, it will clarify all the confusion in the literature.
Note: Shannon understood this distinction and called the uncertainty which is subtracted the 'equivocation'. Shannon (1948) said on page 20:
R = H(x) - Hy(x)
"The conditional entropy Hy(x) will, for convenience, be called the equivocation. It measures the average ambiguity of the received signal."
The mistake is almost always made by people who are not actually trying to use the measure.
http://www.lecb.ncifcrf.gov/~toms/infor ... ainty.html
I'm Confused: How Could Information Equal Entropy?
If someone says that information = uncertainty = entropy, then they are confused, or something was not stated that should have been. Those equalities lead to a contradiction, since entropy of a system increases as the system becomes more disordered. So information corresponds to disorder according to this confusion.
If you always take information to be a decrease in uncertainty at the receiver and you will get straightened out:
R = Hbefore - Hafter.
where H is the Shannon uncertainty:
H = - sum (from i = 1 to number of symbols) Pi log2 Pi (bits per symbol)
and Pi is the probability of the ith symbol. If you don't understand this, please refer to "Is There a Quick Introduction to Information Theory Somewhere?".
Imagine that we are in communication and that we have agreed on an alphabet. Before I send you a bunch of characters, you are uncertain (Hbefore) as to what I'm about to send. After you receive a character, your uncertainty goes down (to Hafter). Hafter is never zero because of noise in the communication system. Your decrease in uncertainty is the information (R) that you gain.
Since Hbefore and Hafter are state functions, this makes R a function of state. It allows you to lose information (it's called forgetting). You can put information into a computer and then remove it in a cycle.
Many of the statements in the early literature assumed a noiseless channel, so the uncertainty after receipt is zero (Hafter=0). This leads to the SPECIAL CASE where R = Hbefore. But Hbefore is NOT "the uncertainty", it is the uncertainty of the receiver BEFORE RECEIVING THE MESSAGE.
A way to see this is to work out the information in a bunch of DNA binding sites.
Definition of "binding": many proteins stick to certain special spots on DNA to control genes by turning them on or off. The only thing that distinguishes one spot from another spot is the pattern of letters (nucleotide bases) there. How much information is required to define this pattern?
Here is an aligned listing of the binding sites for the cI and cro proteins of the bacteriophage (i.e., virus) named lambda:
alist 5.66 aligned listing of:
* 96/10/08 19:47:44, 96/10/08 19:31:56, lambda cI/cro sites
piece names from:
* 96/10/08 19:47:44, 96/10/08 19:31:56, lambda cI/cro sites
The alignment is by delila instructions
The book is from: -101 to 100
This alist list is from: -15 to 15
------ ++++++
111111--------- +++++++++111111
5432109876543210123456789012345
...............................
OL1 J02459 35599 + 1 tgctcagtatcaccgccagtggtatttatgt
J02459 35599 - 2 acataaataccactggcggtgatactgagca
OL2 J02459 35623 + 3 tttatgtcaacaccgccagagataatttatc
J02459 35623 - 4 gataaattatctctggcggtgttgacataaa
OL3 J02459 35643 + 5 gataatttatcaccgcagatggttatctgta
J02459 35643 - 6 tacagataaccatctgcggtgataaattatc
OR3 J02459 37959 + 7 ttaaatctatcaccgcaagggataaatatct
J02459 37959 - 8 agatatttatcccttgcggtgatagatttaa
OR2 J02459 37982 + 9 aaatatctaacaccgtgcgtgttgactattt
J02459 37982 - 10 aaatagtcaacacgcacggtgttagatattt
OR1 J02459 38006 + 11 actattttacctctggcggtgataatggttg
J02459 38006 - 12 caaccattatcaccgccagaggtaaaatagt
^
Each horizontal line represents a DNA sequence, starting with the 5' end on the left, and proceeding to the 3' end on the right. The first sequence begins with: 5' tgctcag ... and ends with ... tttatgt 3'. Each of these twelve sequences is recognized by the lambda repressor protein (called cI) and also by the lambda cro protein.
What makes these sequences special so that these proteins like to stick to them? Clearly there must be a pattern of some kind.
Read the numbers on the top vertically. This is called a "numbar". Notice that position +7 always has a T (marked with the ^). That is, according to this rather limited data set, one or both of the proteins that bind here always require a T at that spot. Since the frequency of T is 1 and the frequencies of other bases there are 0, H(+7) = 0 bits. But that makes no sense whatsoever! This is a position where the protein requires information to be there.
That is, what is really happening is that the protein has two states. In the BEFORE state, it is somewhere on the DNA, and is able to probe all 4 possible bases. Thus the uncertainty before binding is Hbefore = log2(4) = 2 bits. In the AFTER state, the protein has bound and the uncertainty is lower: Hafter(+7) = 0 bits. The information content, or sequence conservation, of the position is Rsequence(+7) = Hbefore - Hafter = 2 bits. That is a sensible answer. Notice that this gives Rsequence close to zero outside the sites.
If you have uncertainty and information and entropy confused, I don't think you would be able to work through this problem. For one thing, one would get high information OUTSIDE the sites. Some people have published graphs like this.
A nice way to display binding site data so you can see them and grasp their meaning rapidly is by the sequence logo method. The sequence logo for the example above is at http://www.lecb.ncifcrf.gov/~toms/galle ... i.fig1.gif. More information on sequence logos is in the section What are Sequence Logos?
More information about the theory of BEFORE and AFTER states is given in the papers http://www.lecb.ncifcrf.gov/~toms/paper/nano2 , http://www.lecb.ncifcrf.gov/~toms/paper/ccmm and http://www.lecb.ncifcrf.gov/~toms/paper/edmm.
http://www.ccrnp.ncifcrf.gov/~toms/bion ... al.Entropy
Barbarian:
Charlie apparently doesn't know what "information" is, much less how to calculate it.
I'm intrigued by the idea that increasing information is a "decrease" in information.
Let's turn this one backwards, Charlie. Suppose God magically created five alleles, instead of doing it the way He did. Then suppose one allele disappears in a population, and there isn't any more.
Is that then a gain in infomation? If not, why is a new allele not an increase in information?
I have to say, Charley, it looks like you're just chanting phrases they taught you in YE indoctrination.
by The Barbarian on Thu Oct 19, 2006 6:50 pm
The difference between Charlies private definition of "information", and that of Shannon (of Bell Labs) is that Shannon's actually works. Hence, the pipes that deliver signals across the internet do so more efficiently because engineers use algorithms based on information as entropy.
Signals from very weak radio sources are accurately recieved from across millions of miles of space because engineers realize that information is entropy.
That kind of information reflects the real world. And, Shannon showed, it is the result of uncertainty.
The point I'm trying to make Barb, is Shannon defined information as uncertainty after receipt. The lower the uncertainty, the greater the information. So the the lower the entropy, the greater the information:
Information Is Not Entropy,
Information Is Not Uncertainty!
Information is always a measure of the decrease of uncertainty at a receiver (or molecular machine).
R = H(x) - Hy(x)
The conditional entropy Hy(x) will, for convenience, be called the equivocation. It measures the average ambiguity of the received signal.
http://www.lecb.ncifcrf.gov/~toms/infor ... ainty.html
by jwu on Fri Oct 20, 2006 2:33 am
The point I'm trying to make Barb, is Shannon defined information as uncertainty after receipt.That website talks about it as the change of uncertainty due to the receipt. That change is maximal when the received message has maximal entropy
From http://www.mdpi.org/entropy/htm/e7010068.htm, which is referenced by the website which you referenced:
Entropy measures lack of information; it also measures information. These two conceptions are complementary.
Information is maximized when uncertainty (entropy), after receipt, is zero.
Entropy measures lack of information. The higher the entropy, the less information. In it's inverse, entropy measures information.
Catch up with you over the weekend, bro.
by The Barbarian on Sat Oct 28, 2006 4:43 am
So tell us, Charlie, why do communications engineers use Shannon's definition of entropy and information, and not yours?
I think you already know why, don't you?"Beware of gifts bearing Greeks." - Laocoon
The Barbarian
123 Christian Pro
Posts: 1260
Joined: Thu Jun 05, 2003 4:43 pm
Website
by Charlie Hatchett on Sat Oct 28, 2006 5:10 am
So tell us, Charlie, why do communications engineers use Shannon's definition of entropy and information, and not yours?
I think you already know why, don't you?
All your doing is strengthening my position. I am using Shannon's theory, by the book, to support my argument. You need to study it, Bro...you still don't understand it, evidenced by your continual comments.Charlie Hatchett
123 Christian Regular
Posts: 441
Joined: Thu Dec 22, 2005 3:01 pm
Website
by jwu on Sat Oct 28, 2006 7:21 am
I am using Shannon's theory, by the book, to support my argument.
Actually the barbarian did that with the allele calculation. You have yet to show any calculation which does not beg the question by presupposing a zero binding specifity which supports your position.
There was once the question if you would consider the emergence of a new binding spot which results in a new feature in an organism to be an increase of information.
Well...actually once you said this:
I contend information has been lost, because the new binding spots are mutations.
So you're saying that it would be a loss of information because it came to be by mutation - apparently you don't even care about what it does. Is that correct?Proud to be on ikester7579's ignore list.jwu
123 Christian Pro
Posts: 1020
Joined: Thu Oct 14, 2004 4:00 am
WebsiteICQ
by The Barbarian on Wed Nov 01, 2006 5:21 am
Charlie's a little put out that Shannon showed that entropy is information in a message.
So he's just denying what Shannon said."Beware of gifts bearing Greeks." - Laocoon
The Barbarian
123 Christian Pro
Posts: 1260
Joined: Thu Jun 05, 2003 4:43 pm
Website
Charlie Hatchett on Wed Nov 01, 2006 9:31 pm
Charlie's a little put out that Shannon showed that entropy is information in a message.
So he's just denying what Shannon said.
Explain to me what Shannon referred to as the "equivocation", and how it affects the information, R, in the equation:
R = H(x) - Hy(x)
This is Shannon 101.
And for the allele statistical data, explain to me how this data can instruct molecules to build proteins.
Until you can do that, Barb, there's no use continuing our debate. I'm debating against someone that doesn't understand the theory we're debating...
There's a saying in science: when you’re in a hole, stop digging...you just get deeper.
Cheers, and I hope you find wisdom in life's journey.
by The Barbarian on Fri Nov 03, 2006 9:43 pm
From Claud Shannon's "A Mathematical Theory of Information":
In Appendix 2, the following result is established:
Theorem 2: The only H satisfying the three above assumptions is of the form:
(information equation)
This theorem, and the assumptions required for its proof, are in no way necessary for the present theory. It is given chiefly to lend a certain plausibility to some of our later definitions. The real justification of these
definitions, however, will reside in their implications. Quantities of the form H Σpi log pi (the constant K merely amounts to a choice of a unit of measure) play a central role in information theory as measures of information, choice and uncertainty.
The form of H will be recognized as that of entropy as defined in certain formulations of statistical mechanics8 where pi is the probability of a system being in cell i of its phase space. H is then, for example, the H in Boltzmann’s famous H theorem. We shall call H Σpi log pi the entropy of the set of probabilities p1 pn. If x is a chance variable we will write H x for its entropy; thus x is not an argument of a function but a label for a
number, to differentiate it from H y say, the entropy of the chance variable y. The entropy in the case of two possibilities with probabilities p and q 1 p, namely
H = -(p log p + q log q) ...
From our previous discussion of entropy as a measure of uncertainty it
seems reasonable to use the conditional entropy of the message, knowing the received signal, as a measure of this missing information. This is indeed the proper definition, as we shall see later. Following this idea
the rate of actual transmission, R, would be obtained by subtracting from the rate of production (i.e., theentropy of the source) the average rate of conditional entropy.
R = H(x) - Hy(x)
The conditional entropy Hy(x) will, for convenience, be called the equivocation. It measures the average ambiguity of the received signal.
So as you see, Shannon showed how information (H) is a measure of entropy in a message.
And for the allele statistical data, explain to me how this data can instruct molecules to build proteins.
Any change that produces a new allele (a mutation) will produce a novel protein, unless it's a point mutation, the change of which produces a triplet that codes for the existing amino acid. Otherwise, the mutation will result in a different protein.
Until you can do that, Barb, there's no use continuing our debate.
Done.
I'm debating against someone that doesn't understand the theory we're debating...
Well, perhaps you'll think differently, knowing what Shannon thought about it.
There's a saying in science: when you’re in a hole, stop digging...you just get deeper.
Nope. The point in science is to get deeper and deeper. That's how it works. We never stop refining it.
Again, you may not like the way Shannon defined information, but fact is, it works. And that's what counts in science."Beware of gifts bearing Greeks." - Laocoon
by Bible Thumpin Fool on Fri Nov 24, 2006 7:19 pm
So as you see, Shannon showed how information (H) is a measure of entropy in a message.
Explain where Shannon showed information was entropy. That's complete rubbish. Your trying to equate randomness and information. Shannon did, however, propose, that as entropy is decreased, information is increased. Again, ask your parents about it...or one of your stats teachers, if your in college yet. From what I've read on this forum so far, these guys defending evolution are ignorant of the facts...so I certainly wouldn't ask them.
Makes for good humor though...haven't laughed this hard in a while.
The thread about Neanderthals not being related to humans was completely laughable...I was rolling!!!
by The Barbarian on Fri Nov 24, 2006 7:42 pm
Explain where Shannon showed information was entropy.
See above. I presented a statement from Shannon doing just that.
That's complete rubbish.
Nope. It's a fact. Would you like me to show you the math? Shannon's demonstration that information equates to entropy has been used to make the internet possible in its present form, and to send very weak signals across millions of kilometers of space with virtually no loss of data.
Your trying to equate randomness and information.
Nope. Information, as Shannon said is a measure of uncertainty in a signal.
Shannon did, however, propose, that as entropy is decreased, information is increased.
See above. You've been misled. Again, here's what Shannon actually wrote:
Quantities of the form H Σpi log pi (the constant K merely amounts to a choice of a unit of measure) play a central role in information theory as measures of information, choice and uncertainty.
The form of H will be recognized as that of entropy as defined in certain formulations of statistical mechanics where pi is the probability of a system being in cell i of its phase space. H is then, for example, the H in Boltzmann’s famous H theorem. We shall call H Σpi log pi the entropy of the set of probabilities p1 pn. If x is a chance variable we will write H x for its entropy; thus x is not an argument of a function but a label for a
number, to differentiate it from H y say, the entropy of the chance variable y. The entropy in the case of two possibilities with probabilities p and q 1 p, namely
H = -(p log p + q log q) ...
Notice that he equates information with entropy.
Again, ask your parents about it...
Regrettably, both of my parents died some years ago, having lived full and rewarding lives. Neither of them actually studied systems analysis or information theory, however, and I have. One of my degrees is in systems.
or one of your stats teachers,
One of them in graduate school introduced me to the theory. I was as incredulous as you are, until I saw the numbers."Beware of gifts bearing Greeks." - Laocoon
The Barbarian
123 Christian Pro
Posts: 1260
Joined: Thu Jun 05, 2003 4:43 pm
Website Top
by Bible Thumpin Fool on Fri Nov 24, 2006 8:04 pm
Wait, you didn't mention R once?
R = H(x) - Hy(x)
R is the info, H is the entropy. H(x) is the uncertainty (entropy) before receipt, and Hy(x) is the amount the uncertainty (entropy) after receipt of the messgage. The result is the R. So the lower the uncertainty, or entropy, after receipt, the higher the info.
For example:
Say your uncertainty before receipt is 4 bits, and your uncertainty after receipt is 4 bits. This means you didn't receive any info:
R=4-4
R=0 bits of info
Another example;
Say your uncertainty before receipt is 4 bits, and your uncertainty after receipt is 0 bits. This means your received 4 bits of info:
R=4-0
R=O
See above. You've been misled.
Sad that a graduate level instructor taught you this...wow!! Amazing he was employed.
Notice that he equates information with entropy.
Rubbish, nonsense, get that out of your head...someone screwed you up big time.
by The Barbarian on Sat Nov 25, 2006 12:07 pm
Shannon, in fact, defined entropy as a measure of the average information content associated with a random outcome.
http://en.wikipedia.org/wiki/Information_entropy
R is the info, H is the entropy. H(x) is the uncertainty (entropy) before receipt, and Hy(x) is the amount the uncertainty (entropy) after receipt of the messgage. The result is the R. So the lower the uncertainty, or entropy, after receipt, the higher the info.
You've gotten it backwards again. Read this, it may be more easily understood.
An intuitive understanding of information entropy relates to the amount of uncertainty about an event associated with a given probability distribution. As an example, consider a box containing many coloured balls. If the balls are all of different colours and no colour predominates, then our uncertainty about the colour of a randomly drawn ball is maximal. On the other hand, if the box contains more red balls than any other colour, then there is slightly less uncertainty about the result: the ball drawn from the box has more chances of being red (if we were forced to place a bet, we would bet on a red ball). Telling someone the colour of every new drawn ball provides them with more information in the first case than it does in the second case, because there is more uncertainty about what might happen in the first case than there is in the second. Intuitively, if there were no uncertainty as to the outcome, then we would learn nothing by drawing the next ball, and so the information content would be zero. As a result, the entropy of the "signal" (the sequence of balls drawn, as calculated from the probability distribution) is higher in the first case than in the second.
Shannon, in fact, defined entropy as a measure of the average information content associated with a random outcome.
(same source)
Sad that a graduate level instructor taught you this...wow!! Amazing he was employed.
Well, he had worked at Bell Labs the same time as Shannon, so they probably figured he knew what he was talking about. Since he presented it as Shannon did, I guess they were right.
Barbarian obseraves:
Notice that he equates information with entropy.
Rubbish, nonsense, get that out of your head...someone screwed you up big time.
You vs. Shannon. Not much of a choice, is it?"Beware of gifts bearing Greeks." - Laocoon
by Bible Thumpin Fool on Sat Nov 25, 2006 12:47 pm
You vs. Shannon. Not much of a choice, is it?
Shannon, in fact, defined entropy as a measure of the average information content associated with a random outcome.
Right. The higher the entropy after receipt, the lower the information content.
Example:
Somebody is supposed to call and give you directions to a party.
Let's say you have 10 bits of uncertainty before the call, because you don't know where in the heck it's supposed to be. Then you receive the call, and the girl giving you directions starts babbling about something unrelated to the directions...then your connection is dropped. So your uncertainty is still 10 bits, because your just as clueless to the directions as you were before the call.
R=10-10
R=O
Info = 0
Dude. Your clueless.
You have no idea what Shannon's Theory is.
Let's take it one step at a time:
R= Information
Are you still with me?
Notice that he equates information with entropy.
My guess, if this guy was one of the engineers, is that you misunderstood him. Every engineer or tech type involved with communication of information knows that the higher your entropy is, the less info that's being transmitted. Of course, he may have been the janitor..who knows?
You vs. Shannon. Not much of a choice, is it?
Now, just remove the Shannon part, and you'll have it right. I'm right in line with Shannon, while you babble your nonsense, in defense of your silly a** philosophy. You guys crack me up big time...acting all scientific like...just as ignorant as can be. Sad and funny!! Bible Thumpin Fool
The Barbarian on Sat Nov 25, 2006 1:29 pm
I showed you Shannon's own words. And I showed you how he determined that entropy was equivalent to information.
Much as I'd love to babble insults with you, it's clear you aren't going to accept what Shannon said, regardless.
But you can at least serve as a bad example."Beware of gifts bearing Greeks." - Laocoon
The Barbarian on Sat Nov 25, 2006 2:59 pm
You've confused meaning with information. Two different things. Read Shannon's article to learn why that's important.
It might be helpful to think again that if the message is completely known in advance, no information is obtained, and if the message is completely unanticipated, (say random string of 0 and 1) the the information of the message is maximized, at the same time H is maximized. Hence, the entropy of the message, is the information.
Bible Thumpin Fool on Sat Nov 25, 2006 3:43 pm
Next, we add the entropy prior to receipt:
R=H(x)
Then, finally, we subtract the entropy after receipt:
R = H(x) - Hy(x)
For example;
Suppose you knew nothing about Shannon's theory prior to talking to me. I'll be very generous, and allow you 10 to the 20th bits of uncertainty. Now suppose I explained it to you, but you weren't listening, because you were more preoccupied with defending you dumb a** philosophy, than seeking truth. So your uncertainty remains at 10 to the 20th bits;
therefore, the information you've gained concerning Shannon's theory:
R= (10 to the 20th bits) - (10 to the 20th bits)
R=0
So the total amount of information you possess concerning Shannon's theory is 0. Of course, the math wasn't really necessary...
by The Barbarian on Sat Nov 25, 2006 8:04 pm
Entropy as information content
It is important to remember that entropy is a quantity defined in the context of a probabilistic model for a data source. Independent fair coin flips have an entropy of 1 bit per flip. A source that always generates a long string of A's has an entropy of 0, since the next character will always be an 'A'.
The entropy rate of a data source means the average number of bits per symbol needed to encode it.
http://en.wikipedia.org/wiki/Information_entropy
It's kind of pointless for you to deny it."Beware of gifts bearing Greeks." - Laocoon
by Bible Thumpin Fool on Sun Nov 26, 2006 4:38 am
Entropy as information content
It's kind of pointless for you to deny it.
Information Is Not Entropy,
Information Is Not Uncertainty!
http://www.lecb.ncifcrf.gov/~toms/infor ... ainty.html
We can still have that spelling bee, if you'd like.
by jwu on Sun Nov 26, 2006 3:50 pm
And the key question remains - uncertainty about what?
The Barbarian on Sun Dec 10, 2006 5:11 pm
I know you found someone to tell you that entropy is not information. But Shannon, as you see, does.
And since his model actually works, he wins.
http://www.christianforums.net/viewtopic.php?f=19&t=25503&st=0&sk=t&sd=a&start=30
http://www.christianforums.net/viewforum.php?f=19&st=0&sk=t&sd=d&sid=37a58863f1e04b43e1b4ce73d885dba6&start=200
Post ID#7109 - replied 4/28/2008 12:42 AM
FireArch
Moderator
I suggest we remain on topic here and keep the mud slinging to near as nil as possible, lest we see the banishment of the both of you by the higher authority. Thus far the flame level on AFW.com has been relatively low and I think the website benefits for it, so let's keep if civil if we can.
Comments should be relevant to the theme of the topic. Also, can we stop quoting entire dissertations when making a point, please? Just quote the relevant part and comment on that.
Thanks.
Post ID#7113 - replied 4/28/2008 1:39 AM
AD
Thanks for the forbearance...
AD
Post ID#18655 - replied 4/17/2011 11:06 AM
livy111us
Post ID#18656 - replied 4/17/2011 11:06 AM
livy111us
Post ID#19390 - replied 2/29/2012 1:41 PM
Dwarmour
Post ID#19391 - replied 2/29/2012 3:39 PM
StarRider
Post ID#19395 - replied 2/29/2012 6:56 PM
StarRider
Post ID#19400 - replied 3/1/2012 5:50 AM
DougRM
Not sure if you know this but simply adding the little copyright (c) to a photo or caption with your name makes the copyright yours assuming you did not steal the photos from someone else (not saying you did, a generic example of what would not make something copyright). Posting a photo here will not affect your copyright.
Though you will understand of most people are highly sceptical of someone who says they have proof but does not share the information regardless of what they are trying to prove.
Most people will not take you serious without proof.
Post ID#19408 - replied 3/1/2012 5:01 PM
StarRider
From what is plainly a piece of rusty net-wire. I'm quite sure there have been more dramatic assertions on this forum, but frankly that's gettin' on up there. Carry on.
Post ID#19415 - replied 3/4/2012 7:10 PM
Dwarmour
Post ID#19416 - replied 3/4/2012 8:45 PM
AED
I wanted to PM you about this topic, but the forum's current software does not provide for this. And then I got busy with something else, during which time your postings vanished for whatever reason (wish I still had them in front of me). I'm the "AD" who posted a few years ago in this discussion (if one can call it that), and who did the preliminary research on Mr. Gillilan's apparent cache find. As you have seen, this not the optimal venue for the topic. I would like very much to see what you have, and will contact you directly if you tell me how. If you'd rather not provide direct contact information here, I can post a secondary email address that's already so garbaged up I'm not too worried about it.
Since the find site has been (conveniently) destroyed, and proper materials analysis is quite time-consuming and expensive, I have not yet pursued this beyond what has been described here and at http://www.daysknob.com/DG.htm . I have, however, run the photos past some archaeometallurgists/professors who have spent many years researching millennia-old iron smelting in Africa, and their assessments stand in marked contrast to the "obviously a nail" comments in this forum. It's been a couple years now, but I was offered the possibility of some pro bono analysis work. I'd try to pursue this with material from secure and verifiable context. For me, prehistoric Native American iron smelting is officially just a hypothesis, but it seems to me a fairly robust one at this point. And I sure don't buy into the notion that a Native American must learn the true history of his people at the feet of white archaeologists who have spent years in school learning about Indians and arrowheads.
Let me know if you want to talk.
Regards, Alan
Post ID#19418 - replied 3/6/2012 4:00 AM
Jennifer Palmer
Webmaster
Jennifer
|
Next topic: "Identification and Management of Traditional Cultural Places - June 2012" |
|
Previous topic: "Lake Champlain Maritime Museum Nautical Archeology Field School" |
|
Looking for something else? Show recent posts in Discussion |


